النتائج 1 إلى 4 من 4

الموضوع: DNA II

  1. #1
    عضو مميز الصورة الرمزية مالك محمد
    تاريخ التسجيل
    Aug 2011
    المشاركات
    2,847

    افتراضي DNA II

    Look around you, most objects you are familiar with will eventually fall into ruin if not constantly maintained: a car will eventually rust and fall to pieces; a house will spring leaks in the roof and fall to the ground; even mountain ranges are eroded by wind and rain. Yet, life on earth continues to flourish. Your children are no weaker or more likely to fall to pieces than you are. This is because living things have a fascinating and somewhat unique ability to reproduce and make “copies” of themselves. To do this, they must first copy their genetic material, their بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى (see our بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى module for more information). And it is the unique chemical properties of DNA that allow it to generate copies of itself. As we all know, living things do eventually age and deteriorate, much like the old house and rusty car, but by making copies of our DNA and passing it to our offspring, life continues.

    The building blocks of DNA

    Scientists first began to investigate the unique chemical properties of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى long before the structure of the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى was understood, and even before DNA was discovered to be the genetic material. In the late 1800s, J. Friedrich Miescher was a Swiss chemist, working in Germany, and was studying white blood cells (leukocytes). Because white blood cells are the principal component of pus, Miescher would go to the nearby hospital and collect pus from used bandages. He found that the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى of these cells was rich in a then-unknown substance that contained several بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , among them phosphorous and nitrogen. He called this substance “nuclein” because it was found in the nucleus of the cells. We now know that Miescher’s “nuclein” (later renamed بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , for its acidic chemical properties) contained DNA.
    In the early 1900s, the Lithuanian-American biochemist بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , probed deeper into the chemical composition of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى and was able to further purify the material. Although Levene was not the first scientist to successfully purify بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , he was uniquely qualified to correctly determine its composition – he had extensive expertise in the area of carbohydrate and بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى chemistry. When Levene analyzed the chemical properties of nucleic بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , he discovered that DNA was abundant in three things: five-carbon sugars (pentoses), phosphate (as Miescher had previously found), and nitrogen بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى . Thus, Levene correctly deduced that the DNA بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى was made of smaller molecules linked together, and these smaller molecules, which he named بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , were made of three parts – a five-carbon sugar, a phosphate group (PO4), and one of four possible nitrogen bases – adenine, cytosine, guanine, or thymine (often abbreviated A, C, G, and T). Levene was correct in identifying the three parts of a nucleotide, and determining that nucleotides were linked together to make DNA; however, in 1928, he also incorrectly proposed that one of each of the four nucleotides was linked together in a small circular molecule and that these “tetranucleotides” were the basis of DNA (بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى (Figure 1).
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    ©John Schmidt
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 1: Phoebus Levene incorrectly hypothesized that DNA was made of circular “tetranucleotides.”
    Because he thought بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى was a simple circular structure, Levene rejected the notion that it could be the genetic material and sided firmly with those who believed that بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى contained the genetic code of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى . However, much later, in the 1940s, Austrian-American scientist بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى reported that DNA from various بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى of life forms had different amounts of the four بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى (بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى ). This strongly argued against Levene’s بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى that DNA was simply a circular tetranucleotide, and scientists began to propose other possible structures of the DNA بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى . Despite what he got wrong, Levene’s contributions to our understanding of the DNA molecule were substantial.
    Thanks to the work of Levene and several others, the chemical structure of the individual بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى was established by the early 1910s. Below are diagrams of the three parts of a nucleotide (Figure 2).
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 2: A nucleotide. The five-carbon sugar deoxyribose forms the center of the molecule. Attached to carbon #1 is the nitrogen base, and attached to carbon #5 is the phosphate group (there may be 1, 2, or 3 phosphates in a nucleotide)
    The بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى deoxyribose gets its name because when it was discovered (by Levene), it was found to lack one oxygen بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى when compared to another sugar he discovered called ribose (Figure 3).
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 3: Ribose vs. Deoxyribose. These two pentoses, or five carbon sugars, differ only in the presence of an oxygen on ribose at the #2 carbon. At the #2 carbon of deoxyribose, a H exists in place of the –OH group on ribose; however, lone hydrogens are often omitted from drawings of organic molecules, as above.
    The oxygen missing from deoxyribose is on carbon #2, thus the full name of the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى is 2’-deoxyribose. (In biochemistry, the carbons in sugar groups are often numbered with the “prime” symbol (as in 2’), to clarify that the carbon referred to is in the sugar and not another part of the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى .)
    Levene correctly deduced the connections between the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , and the chemical name for these connections are “phosphodiester bonds.” These bonds are often casually referred to as “5’ to 3’ connections” because a phosphate بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى (PO4) serves as the bridge between the 5’ carbon of one nucleotide and the 3’ carbon of the next (Figure 4).
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    ©Visionlearning, Inc.
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 4: phosphodiester bonds. Nucleotides are connected to one another through a phosphate group that is connected to the 5’ carbon of one nucleotide and the 3’ nucleotide of another.
    Although Levene originally thought that four بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى were connected together in a circular بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , we now know that the individual nucleotides are connected to form a very long بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى structure (Figure 5).
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    ©Visionlearning, Inc.
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 5: A chain of nucleotides. As shown in this linear drawing, the sugar and phosphate groups connect in a long chain and this is referred to as the “sugar-phosphate backbone,” while the nitrogen bases are attached to the backbone.
    The four بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى are grouped into two “families” based on their chemical structure: the purines, Adenine and Guanine, have a structure with two rings; and the pyrimidines, Cytosine and Thymine, have only one ring (Figure 6).
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 6: The nitrogen bases. Shown here are the four different nitrogen bases found in DNA nucleotides. Note that Guanine and Adenine, the purines, have two rings, while Cytosine and Thymine, the pyrimidines, have only one ring.
    Thus, the strands of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى inside our cells are بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى of repeating units of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى . It is the precise order, or sequence, of the billions of nucleotides, A’s, C’s, G’s, and T’s that make up our own unique DNA بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى and give us our individual genetic traits.
    The discovery of the double helix

    Once the building blocks of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى were fully understood, by the late 1940s and early 1950s, scientists began to study the larger structure of DNA by taking بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى pictures of purified DNA بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى . However, the pictures they took were not consistent with a simple بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى strand of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , as depicted in Figure 5. Instead, the pictures argued that DNA is even more complex and has a very regular and symmetrical shape. A number of scientists began to propose possible structures for the DNA molecule based on this research. Because the pictures argued for a symmetrical shape and chemical evidence argued that DNA was a بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى of nucleotides, many scientists thought that multiple strands wrapped around each other, like a braid or a rope. In fact, بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , a prominent American scientist, had envisioned that DNA might be a triple helix – three strands of nucleotides wrapping around each other. Pauling, who would later win a بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى for correctly deducing the “alpha-helix” structure of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , even published a paper proposing a triple helix model of DNA in 1953 (بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى ). However, Pauling’s practice of building models of molecular structures caught on with many biochemists of the day, and this time period has been referred to as the era of model building.
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    ©CWP and The Regents of the University of California
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 7: Rosalind Franklin (25 July 1920 – 16 April 1958), a chemist who made vital contributions to the understanding of the fine molecular structures of DNA and RNA. Franklin is best known for her work on X-ray diffraction images of DNA, which James Watson and Frances Crick used to formulate their 1953 hypothesis about the structure of DNA.
    Several variants of a helix-shaped بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى were proposed by other scientists. In 1951, the English molecular biologists بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى and بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى had published their own incorrect version of a triple helix model. However, the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى pictures at the time were all relatively poor quality and resolution. As the technique was further refined, a brilliant chemist named بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى (Figure 7), working at King’s College in England, was able to take much higher-resolution بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى pictures.
    Franklin’s high quality pictures confirmed that بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى is actually a double helix – two strands wrapped around each other. However, the first double-stranded بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى built by Watson and Crick had the sugar-phosphate backbones of two strands wrapped around each other and the nitrogen بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى pointing outward. It was بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى who pointed out the error in this model. She reminded Watson and Crick that the nitrogen bases are not very soluble in water and thus they would not be pointed outward where they would be surrounded by nearby water molecules in the cell. Instead, she argued, the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى and phosphates, which are soluble in water, would be pointed outwards, towards the water, and the nitrogen bases would likely be tucked into the interior of the molecule, away from the water molecules, and perhaps interacting with each other.
    This was a crucial piece of advice for Watson and Crick, leading them to take their model apart and begin to build a new one. This time, they built the double helix with the sugar-phosphate backbones on the outside of the helix and the nitrogen بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى facing inward. They realized that the nitrogen bases of the two strands would now be in proximity with one another and would likely interact. A crucial piece of evidence that helped them figure this out came from Erwin Chargaff’s studies. In addition to demonstrating that different بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى had different amounts of the four nitrogen bases of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , in 1951, Chargaff also reported that the amount of Adenine (A) always equals the amount of thymine (T) and the amount of cytosine (C) always equals the amount of guanine (G). This is now known as “Chargaff’s law.” With Chargaff’s law in mind, Watson and Crick had a revelation. They reasoned that if the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى is double-stranded, perhaps every time that an A was on one strand of the molecule, a T appears in the complimentary position on the opposite strand (and vice versa), further, every time a C was on one side, a G would be on the other. This would explain why Chargaff’s law held true. But, there was one problem. The nitrogen bases did not “fit together” in this configuration. Franklin had taken very good pictures of the DNA molecule that demonstrated that it was a tightly packed, narrow structure. When large molecules interact tightly, the smaller constituent molecules that closely pack together must be “complementary” like two inter-locking pieces of a puzzle. For example, a negative charge will be closely associated with a positive charge, etc. Watson and Crick knew that their model wasn’t quite right, because the nitrogen bases were not fitting together very well.
    The final revelation that allowed Watson and Crick to complete their model came in a moment described as “a stroke of inspiration” when Watson realized that the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى would fit together if one was “upside down” relative to the other. (According to Watson, he saw this possibility as he sat across a small table from Crick, both of them working with small models of nucleotides.) This upside down orientation would occur if the two strands that wrap around each other are not pointed in the same direction, but in opposite directions. Thus, these two strands are said to be anti-parallel, like the traffic on a two-lane highway (Figure 8).
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    ©Visionlearning, Inc.
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 8: Antiparallel nature of the DNA double helix. Notice how the sugar-phosphate backbone is on the outside of the “ladder” while the bases point inward. Notice also how the orientation of the two strands is “antiparallel” and thus look upside down compared to each other. This is most easily seen by looking at the pentose sugars (orange).
    Suddenly, everything made sense! With the two strands wrapping around each other in an anti-parallel configuration, Watson and Crick were able to fit the strands very close together, as Franklin’s picture shows them to be, and the structure is regular and symmetrical. Most importantly, the nitrogen بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى fit perfectly together through a type of chemical attraction called a بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى . Hydrogen bonds hold the two strands together stably, but not permanently. Specifically, an Adenine-Thymine “base pair” has two hydrogen bonds and a Cytosine-Guanine base pair has three hydrogen bonds (see Figure 8 above).
    Given this anti-parallel structure, to distinguish the two strands of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , scientists say that one strand is oriented “5’ to 3’” and the other strand is “3’ to 5’.” This is in reference to the 5’-3’ connections in the phosphate-sugar backbone. The machinery of the cell also uses this orientation to select which direction to read the genetic information contained in the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى sequence. Imagine trying to read an English sentence going from right to left. This would make no sense because the proper direction of reading English is left to right. Similarly, the DNA code must be read in the correct direction, which is 5’ to 3’.
    The beauty of the double-stranded anti-parallel configuration is found in the complementary بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى pairing according to Chargaff’s law. If we know the sequence of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى on one strand, we can accurately predict the nucleotides on the other. An Adenine on one side of the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى would be paired with a Thymine on the other side, and so on. Thus, if the two strands are separated, we could look at either strand and know exactly what was on the complementary strand. In fact, this is precisely what happens during DNA replication: the DNA double helix is pried apart or “unzipped” and both of the single strands then serve as copy templates for synthesizing a new strand. The result is two new DNA double helixes, both of which are identical to each other and to the original strand (Figure 9).
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    ©Visionlearning, Inc.
    بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى
    Figure 9: Schematic of DNA replication method proposed by Watson and Crick. In this model, the two strands of the original DNA molecule are first pried apart. Then, complimentary nucleotides (A with T, G with C, etc.) are added opposite of both of the original strands. The result is two DNA molecules, both identical to the original strand (and thus to each other), and both with one old strand and one new strand.
    Once Watson and Crick had built the correct model, all could see that the anti-parallel configuration and the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى base-pairing allowed this simple and effective means of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى self-replication. In fact, the final sentence of their 1953 research article announcing the structure of DNA was, “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.” Watson and Crick published their model of DNA in the journal Nature in 1953, a model which earned them the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى in 1962.
    There has been much debate about whether بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , as a rare female scientist in the 1950s, received enough credit for her crucial contributions to this important discovery. Unfortunately, she died from ovarian cancer just five years after the model was built and بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى are not given posthumously. In the 1950s, scientists were not aware of the cancer risks involved with repeated X-ray exposure and did not properly protect themselves from the radiation given off by these instruments. Thus, it is conceivable that Franklin’s premature death was a direct result of her dedication to scientific research and her pursuit of the structure of the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى .
    But how does بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى store information?

    With the discovery of the structure of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى , a number of fascinating properties of the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى were revealed. Not only can the molecule replicate itself, but the information stored in the بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى sequence of a single DNA strand stores all of the genetic information in your body. Think of the phone numbers stored in your cell phone. Each digit by itself means nothing. But when strung together in a precise sequence (e.g. 6-4-6-5-5-7-4-5-0-4), these numbers form a code for contacting another specific telephone. The same is true for DNA. The bases T, C, A and G mean nothing by themselves. However, a long sequence such as ATGGCTAGCTCGATCGTACGT… can form the code for building an important molecule in your body. This molecule may then perform a function in your body that allows your heart to beat, your stomach to digest, your muscle to flex, or your brain to think. Thus, because these sequences of بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى provide the information for the cell to build بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى and other molecules, DNA is often called the “blueprint of life.” How this بعد التسجيل عليك الرد بكلمة شكرا وعمل refresh للصفحة لرؤية المحتوى في المشاركة الاولى is actually used by cells to build other molecules is explored in additional modules.

    عضو في نادي ماركا الأكاديمي


  2. #2
    مراقب عام الصورة الرمزية Eiman
    تاريخ التسجيل
    Jul 2011
    الدولة
    الاردن - ماركا
    المشاركات
    14,750

    افتراضي رد: DNA II

    شكرا اخ مالك
    من جد وجد ....... ومن سار على الدرب وصل

  3. #3
    عضو فعال الصورة الرمزية Fuad Badawi
    تاريخ التسجيل
    Aug 2011
    الدولة
    AMMAN
    المشاركات
    59

    افتراضي رد: DNA II

    Thank you

    عضو في نادي ماركا الأكاديمي


  4. #4
    عضو ذهبي الصورة الرمزية تامر يوسف
    تاريخ التسجيل
    Mar 2012
    المشاركات
    307

    افتراضي رد: DNA II

    thank you so much
    yeslamoooo

    عضو في نادي ماركا الأكاديمي


معلومات الموضوع

الأعضاء الذين يشاهدون هذا الموضوع

الذين يشاهدون الموضوع الآن: 1 (0 من الأعضاء و 1 زائر)

المفضلات

ضوابط المشاركة

  • لا تستطيع إضافة مواضيع جديدة
  • لا تستطيع الرد على المواضيع
  • لا تستطيع إرفاق ملفات
  • لا تستطيع تعديل مشاركاتك
  •